A PCR-based strategy for cloning short hairpin sequences: “PCR shagging"

A PCR-based strategy for cloning short hairpin sequences:
“PCR shagging”.
Our overall approach is to use an RNA polymerase III promoter to drive
expression of encoded short hairpin RNA (shRNA). For this purpose we use the U6
snRNA promoter and maintain the transcript initiating “G” nucleotide of the U6snRNA
transcript. There by, hairpin sequences will start with a “G”. Termination is mediated
by a run of Ts at the end of the hairpin.
The major difference between our hairpins those reported by others is that we
went through a battery of tests of hairpin length and structure, and found that hairpins of
27 to 29nt in length are more effective than hairpins of 19nt and 21nt. Additionally, we
use a few G-U pairing in the hairpin stem (which are permitted in dsRNA alpha helices)
to stabilize hairpins during propogation in bacteria.
We have developed a fast and effective, PCR-based strategy to clone shRNA
sequences. In this strategy, short hairpin RNA (shRNA) sequences are converted into a
single ~73nt primer sequences onto which are added 21nt of homology to the human U6
snRNA promoter. Such primers have performed flawlessly so far in PCR reactions
(n>40) and subsequent cloning.
PCR
TA/Topo
Cloning
HindIII site
Transient transfection Subcloning (eg Invitrogen’s Gateway
system)
U6 promoter
U6 promoter Ts
U6 promoter Ts
There are several steps in generating hairpin primers. First, a 29nt “sense” sequence
which ends with a “C” is picked out from the coding sequence of gene of interest.
Second, the actual hairpin is constructed in a 5’->3 orientation with respect to the
intended transcript.
Anti-sense Loop Sense Term
ggctatgaagagatacgccctggttccGaagcttGggaaccagggcgtatctcttcatagccTTTTTTG
Predicted shRNA structure
5’->3’ Anti-sense strand
-------| GAA
GGCUAUGAAGAGAUACGCCCUGGUUCC G
CCGAUACUUCUCUAUGCGGGACCAAGG C
UU^ GUU
3’<-5’ Sense strand
Third, a few stem pairing are changed to G-U by altering the sense strand sequence. G-U
base pairing seems to be essential for stability of short hairpins in bacteria and does
not interfere with silencing. Finally, the hairpin construct is converted to its “reverse
complement” onto which is added 21nt of homology to the Human U6 promoter.
Hairpin portion of the primer (~69nt)
CAAAAAAggctatgaagagaCacgccctgAttccCaagcttCggaaccagggcgtatctcttcatagcc
+
U6 promoter reverse primer sequence
Ggt gtt tcg tcc ttt cca caa
Final primer (5’->3’, just as it would be ordered)
CAAAAAAggctatgaagagaCacgccctgAttccCaagcttCggaaccagggcgtatctcttcatagcc
Ggt gtt tcg tcc ttt cca caa
All of the aforementioned steps are automated using a program developed by Ravi
Sachidanandam and Jeremiah Faith (CSHL) where either accession numbers from
GenBank or raw sequences are required to generate hairpin PCR primers.
[Note: Don’t let the G-U pairings represented in the primer fool you into thinking
the primer is incorrect. ]
A link to the hairpin primer generation program, the “RNAi oligo retriever”, can be
found at:
www.cshl.org/public/SCIENCE/hannon.html
Make sure that you enter accession numbers and sequences which match cDNA or
exon sequences!

Methods:

THE PROTOCOL
Ordering Primers
Since very little primer is required for the PCR reaction they can be ordered .05μmol
scale from Sigma-Genosys or whomever. We find that PAGE purification is costly and
unnecessary (PCR will fill in shorted primers!).

PCR
We use a pGEM1 plasmid containing the human U6 locus (N. Hernandez, CSHL) as the
template for the PCR reaction. This vector contains ~500bp of upstream U6 promoter
sequence. Since an SP6 sequence flanks the upstream portion of the U6 promoter, we
use an SP6 oligo as the universal primer in U6-hairpin PCR reactions.
SP6 sequence: GATTTAGGTGACACTATAG
We have had consistently good results using Taq polymerase for PCR with 4% DMSO
and 50pmoles of each primers. (For pENTR/D-Topo cloning [see below], I add .1uL
of Vent to polish the ends.)
PCR conditions: 95° for 3 min; 30 cycles of 95° for 30 sec, 55° for 30 sec, & 72° for 1
min; followed by one cycle of 72° for 10 min.
The PCR product will be ~600bp in length.

CLONING
We currently use two cloning technologies available from Invitrogen: T-A and
directional topoisomerase-mediated cloning kits (catalog #K2040-10, K2400-20). The
directional cloning kit is designed for Invitrogen’s Gateway system. We use both kits
according to the manufacture’s instructions. If using Topo-cloning, do NOT gel purify
PCR products – it reduces the efficiency of the Topo-reaction.
pENTR/D-Topo SP6 primer: CACC GATTTAGGTGACACTATAG
For convenient identification of clones containing the proper insert (20-100% for Topocloning),
a HindIII site has been designed into the loop of the hairpin. A second HindIII
site exists 5’ of U6 promoter. Digesting clones with HindIII releases a ~500bp fragment.
SP6-U6 promoter PCR product sequence (with out hairpin)*.
SP6—HindIII—BamHI—U6 promoter