728

Search Sites

Google

Thursday, February 23, 2012

A PCR-based strategy for cloning short hairpin sequences: “PCR shagging"

A PCR-based strategy for cloning short hairpin sequences:
“PCR shagging”.
Our overall approach is to use an RNA polymerase III promoter to drive
expression of encoded short hairpin RNA (shRNA). For this purpose we use the U6
snRNA promoter and maintain the transcript initiating “G” nucleotide of the U6snRNA
transcript. There by, hairpin sequences will start with a “G”. Termination is mediated
by a run of Ts at the end of the hairpin.
The major difference between our hairpins those reported by others is that we
went through a battery of tests of hairpin length and structure, and found that hairpins of
27 to 29nt in length are more effective than hairpins of 19nt and 21nt. Additionally, we
use a few G-U pairing in the hairpin stem (which are permitted in dsRNA alpha helices)
to stabilize hairpins during propogation in bacteria.
We have developed a fast and effective, PCR-based strategy to clone shRNA
sequences. In this strategy, short hairpin RNA (shRNA) sequences are converted into a
single ~73nt primer sequences onto which are added 21nt of homology to the human U6
snRNA promoter. Such primers have performed flawlessly so far in PCR reactions
(n>40) and subsequent cloning.
PCR
TA/Topo
Cloning
HindIII site
Transient transfection Subcloning (eg Invitrogen’s Gateway
system)
U6 promoter
U6 promoter Ts
U6 promoter Ts
There are several steps in generating hairpin primers. First, a 29nt “sense” sequence
which ends with a “C” is picked out from the coding sequence of gene of interest.
Second, the actual hairpin is constructed in a 5’->3 orientation with respect to the
intended transcript.
Anti-sense Loop Sense Term
ggctatgaagagatacgccctggttccGaagcttGggaaccagggcgtatctcttcatagccTTTTTTG
Predicted shRNA structure
5’->3’ Anti-sense strand
-------| GAA
GGCUAUGAAGAGAUACGCCCUGGUUCC G
CCGAUACUUCUCUAUGCGGGACCAAGG C
UU^ GUU
3’<-5’ Sense strand
Third, a few stem pairing are changed to G-U by altering the sense strand sequence. G-U
base pairing seems to be essential for stability of short hairpins in bacteria and does
not interfere with silencing. Finally, the hairpin construct is converted to its “reverse
complement” onto which is added 21nt of homology to the Human U6 promoter.
Hairpin portion of the primer (~69nt)
CAAAAAAggctatgaagagaCacgccctgAttccCaagcttCggaaccagggcgtatctcttcatagcc
+
U6 promoter reverse primer sequence
Ggt gtt tcg tcc ttt cca caa
Final primer (5’->3’, just as it would be ordered)
CAAAAAAggctatgaagagaCacgccctgAttccCaagcttCggaaccagggcgtatctcttcatagcc
Ggt gtt tcg tcc ttt cca caa
All of the aforementioned steps are automated using a program developed by Ravi
Sachidanandam and Jeremiah Faith (CSHL) where either accession numbers from
GenBank or raw sequences are required to generate hairpin PCR primers.
[Note: Don’t let the G-U pairings represented in the primer fool you into thinking
the primer is incorrect. ]
A link to the hairpin primer generation program, the “RNAi oligo retriever”, can be
found at:
www.cshl.org/public/SCIENCE/hannon.html
Make sure that you enter accession numbers and sequences which match cDNA or
exon sequences!

Methods:

THE PROTOCOL
Ordering Primers
Since very little primer is required for the PCR reaction they can be ordered .05μmol
scale from Sigma-Genosys or whomever. We find that PAGE purification is costly and
unnecessary (PCR will fill in shorted primers!).


PCR
We use a pGEM1 plasmid containing the human U6 locus (N. Hernandez, CSHL) as the
template for the PCR reaction. This vector contains ~500bp of upstream U6 promoter
sequence. Since an SP6 sequence flanks the upstream portion of the U6 promoter, we
use an SP6 oligo as the universal primer in U6-hairpin PCR reactions.
SP6 sequence: GATTTAGGTGACACTATAG
We have had consistently good results using Taq polymerase for PCR with 4% DMSO
and 50pmoles of each primers. (For pENTR/D-Topo cloning [see below], I add .1uL
of Vent to polish the ends.)
PCR conditions: 95° for 3 min; 30 cycles of 95° for 30 sec, 55° for 30 sec, & 72° for 1
min; followed by one cycle of 72° for 10 min.
The PCR product will be ~600bp in length.


CLONING
We currently use two cloning technologies available from Invitrogen: T-A and
directional topoisomerase-mediated cloning kits (catalog #K2040-10, K2400-20). The
directional cloning kit is designed for Invitrogen’s Gateway system. We use both kits
according to the manufacture’s instructions. If using Topo-cloning, do NOT gel purify
PCR products – it reduces the efficiency of the Topo-reaction.
pENTR/D-Topo SP6 primer: CACC GATTTAGGTGACACTATAG
For convenient identification of clones containing the proper insert (20-100% for Topocloning),
a HindIII site has been designed into the loop of the hairpin. A second HindIII
site exists 5’ of U6 promoter. Digesting clones with HindIII releases a ~500bp fragment.
SP6-U6 promoter PCR product sequence (with out hairpin)*.
SP6—HindIII—BamHI—U6 promoter

An Introduction to Genetic Analysis for DNA Protein interactions

An Introduction to Genetic Analysis. Table of Contents

On almost every page of Introduction to Genetic Analysis, we recreate the landmark experiments in genetics and have the students analyze the data and draw ...
www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=iga.TOC

Modern Genetic Analysis. Table of Contents

Modern Genetic Analysis was written for instructors and students who need a textbook that supports the 'DNA first' approach. Griffiths, Anthony JF; Gelbart, ...
www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mga.TOC

Springer Protocols: Abstract: Genetic Analysis of DNA-Protein Interactions Using a Reporter Gene Assay in Yeast.

High-resolution genetic analysis of DNA-protein interactions is particularly problematic in metazoans. We have devised an approach that makes use of the ...
www.springerprotocols.com/Abstract/doi/10.1385/1-59259-208-2:431

Genetic analysis of prokaryotic and eukaryotic DNA-binding Proteins in E. Coli.

Bacterial Two-Hybrid Analysis of Interactions between Region 4 of the {sigma}70 Subunit ... system for studying protein-DNA and protein-protein interactions ...
nar.oxfordjournals.org/cgi/content/abstract/26/16/3700

Quantifying DNA−protein interactions by double-stranded DNA .

Moreover, measuring DNA−protein interactions in different buffer ..... Parallel analysis of genetic selections using whole genome oligonucleotide arrays. ...
www.nature.com/nbt/journal/v17/n6/full/nbt0699_573.html

Genetic Analysis, Using P22 Challenge Phage, of the Nitrogen Activator Protein DNA-Binding Site in the Klebsiella Aerogenes Put Operon.

If a mutation in the site prevents the DNA-protein interaction, ant is expressed ..... Genetic analysis of pathogenic bacteria: a laboratory manual. ...
jb.asm.org/cgi/content/full/180/3/571?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=p

Quantitative prediction of NF-kappa B DNA- protein interactions ...

Genetics Quantitative prediction of NF- kappa B DNA- protein interactions. Irina A. Udalova dagger , Dagger ,§, Richard Mott dagger , Dagger ...
www.pnas.org/cgi/content/abstract/99/12/8167

Genomic analysis of protein–DNA interactions in bacteria: insights into transcription and chromosome organization

Jun 16, 2007 ... Genomic analysis of protein–DNA interactions in bacteria: ... and genetic approaches have been used to study protein–DNA interactions. ...
http://www.blackwell-synergy.com/doi/abs/10.1111/j.1365-2958.2007.05781.x

Development of genetic analysis technique using stable isotope marking molecular switch

Development of genetic analysis technique using stable isotope marking ... of them is a development of fast analysis method of the DNA-protein interaction, ...

http://sciencelinks.jp/j-east/article/200517/000020051705A0653408.php

Genetic Analysis of Yeast RPA1 Reveals Its Multiple Functions in DNA Metabolism...

The Phosphorylation Domain of the 32-kDa Subunit of Replication Protein A (RPA) Modulates RPA-DNA Interactions: EVIDENCE FOR AN INTERSUBUNIT INTERACTION ...
www.genetics.org/cgi/content/abstract/148/3/989

Quantitative whole-genome analysis of DNA-protein interactions by in vivo methylase protection in E. coli

Quantitative whole-genome analysis of DNA-protein interactions by in vivo methylase protection in E. coli. Saeed Tavazoie1 & George M. Church

http://www.nature.com/nbt/journal/v16/n6/abs/nbt0698-566.html

From “Simple” DNA-Protein Interactions to the Macromolecular Machines of Gene Expression

In defining the underlying ideas of DNA-protein interactions, one can, ..... although this genetic analysis tells us little about the relative shapes or ...

http://arjournals.annualreviews.org/doi/abs/10.1146/annurev.biophys.34.040204.144521

ScienceDirect - Genetic Analysis: Biomolecular Engineering.

ScienceDirect - the world's leading platform offers over 2000 high quality peer-reviewed full-text journals and books on science, technology and medicine.
www.sciencedirect.com/science/journal/10503862

Protein-DNA interactions

Genetic analysis. Isolation of mutants in the DNA binding site help to ... under low ionic-strength conditions, which favor strong DNA-protein interactions. ...
www.biochem.arizona.edu/classes/bioc568/protein_dna_interactions.htm

DPInteract

Robison, K., and Church, G. DPInteract: A database on DNA-protein interactions. ... SeqAnalRef, a bibliography on biological sequence analysis ...
arep.med.harvard.edu/dpinteract/

Animal Perfusion Solution

4% Paraformaldehyde (For ICC & 5' Nucleutidase staining)

100 ml 250 ml 300 ml 500 ml 1000ml

Paraformaldehyde 4g 10g 12g 20g 40g

ddH2O 80ml 200ml 240ml 400ml 800ml

heat mixture (do not exceed 65 C) with stirring

add a few drops 50% NaOH to clear solution, add:

NaCl 0.8g 2g 2.4g 4g 8g

KCl 0.02g 0.05g 0.06g 0.1g 0.2g

Na2HPO4 0.061g 0.152g 0.182g 0.305g 0.61

KH2PO4 0.02g 0.05g 0.06g 0.1g 0.2g

pH solution to 7.0-7.5 with paper pH strips

Volume to 100ml 250ml 300ml 500ml 1000ml

Filter entire solution

Cool on ice

2% Paraformaldehyde (200 ml)

Paraformaldehyde 4g

ddH2O 160ml

heat mixture (do not exceed 65 C) with stirring

add a few drops 50% NaOH to clear solution, add:

NaCl 1.6 g

KCl 0.04 g

Na2HPO4 0.122 g

KH2PO4 0.04 g

pH solution to 7.0-7.5 with paper pH strips

Volume to 200 ml

Filter entire solution

Cool on ice

Thursday, June 30, 2011

Chromosome In Situ Hybridization

A modern approach to the specific location of genes on chromosomes is a technique for the hybridization of DNA and RNA "in situ." With this procedure, specific radioactive RNA or DNA (known as probes) can be isolated (or synthesized "in vitro") and then annealed to chromosomes which have been treated in such a manner that their basic double stranded DNA has been "melted" or dissociated.

In theory, and fortunately in practice, when the DNA is allowed to re-anneal, the probe competes for the binding, but only where it mirrors a complimentary sequence. Thus, RNA will attach to the location on the chromosome where the code for its production is to be found. DNA will anneal to either RNA which is still attached to a chromosome, or to the complimentary sequence DNA strand within the chromosome. Since the probe is radioactive, it can be localized via autoradiographic techniques.

Finally, it is possible to produce an RNA probe that is synthesized directly from repetitive sequences of DNA, such as that found within the nucleolar organizer region of the genome. This RNA is known as cRNA (for copied RNA) and is a convenient source of a probe for localizing the nucleolar organizer gene within the nucleus, or on a specific chromosome.

The use of in situ hybridization begins with good cytological preparations of the cells to be studied, and the preparation of pure radioactive probes for the analysis. The details depend upon whether the hybridization is between DNA (probe) and DNA (chromosome), DNA (probe) and RNA (chromosome), or between RNA (probe) and DNA (chromosome).

Preparation of the Probe:

Produce radioactive RNA by incubating the cells to be measured in the presence of ^3H-uracil, a specific precursor to RNA. Subsequent to this incubation, extract rRNA from the sample and purify through differential centrifugation, column chromatography or electrophoresis. Dissolve the radioactive RNA probe in 4X Saline-Citrate containing 50% formamide to yield a sample that has 50,000 to 100,000 counts per minute, per 30 microliter sample, as determined with a scintillation counter. Add the formamide is added to prevent the aggregation of RNA.

Preparation of the Slides:

Fix the materials to be studied in either 95% ethanol or in 3:1 methanol:water, attach to pre-subbed slides (as squashes for chromosomes) and air dry.

Hybridization

Place the air dried slides into a moist chamber, usually a disposable petri dish containing filter paper and carefully place 30 microliters of RNA probe in 4X SSC-50% formamide onto the sample.

Carefully add a cover slip (as in the preparation of a wet mount), place the top on the container and place in an incubator at 37° C for 6-12 hours.

Washing:

Pick up the slides and dip into 2X SSC so that the coverglass falls off.

Place the slides in a coplin jar containing 2X SSC for 15 minutes at room temperature.

Transfer the slides to a treatment with RNase (50 microgram/ml RNase A, 100 units/ml RNase T1 in 2X SSC) at 37° C for 1 hour.

Wash twice in 2X SSC, 15 minutes each.

Wash twice in 70% ethanol, twice in 95% ethanol and air dry.

Autoradiography:

Add photographic emulsions to the slides and after a suitable exposure period, develop the slides, counterstain and add cover slips.

Analyze the slides by determining the location of the radioactive probe on the chromosomes or within the nuclei.

(Dr. William H. Heidcamp)

H and E Stain Full Protocol

Paraffin processing of tissue

Fixation of Tissues

1. Where the best possible morphology is required, animals should be anesthesized and subjected to cardiac perfusion with saline, followed by a 10% formalin flush. If biochemical studies need to be performed on the tissue, a 10% formalin flush should not be used as it may interfere with subsequent analysis.

2. For routine stains where perfusion is not required, tissue is sectioned and drop-fixed in a 10% formalin solution. Fixative volume should be 20 times that of tissue on a weight per volume; use 2 ml of formalin per 100 mg of tissue.

3. Due to the slow rate of diffusion of formalin (0.5 mm hr), tissue should be sectioned into 3 mm slices on cooled brain before transfer into formalin. This will ensure the best possible preservation of tissue and offers rapid uniform penetration and fixation of tissue within 3 hours.

4. Tissue should be fixed for a minimum 48 hours at room temperature.

5. After 48 hours of fixation, move tissue into 70% ethanol for long term storage.

6. Keep fixation conditions standard for a particular study in order to minimize variability. (Although set times are best, tissue may be fixed for substantially longer periods without apparent harm.

A few notes on fixation

The usual fixative for paraffin embedded tissues is neutral buffered formalin (NBF). This is equivalent to 4% paraformaldehyde in a buffered solution plus a preservative (methanol) which prevents the conversion of formaldehyde to formic acid. Because of the preservative, NBF has a shelf life of months, whereas 4% PF must be made fresh. Optimal histology requires adequate fixation, about 48 hrs at room temperature for thinly sliced tissues. Inadequately fixed tissues will become dehydrated during tissue processing, resulting in hard and brittle specimens. Alcohol based fixatives generally do not give good morphology but may be useful in special cases (such as BrdU staining). A particular challenge for the histopathology is immunostaining fixed specimens. In many cases formaldehyde fixation will prevent recognition of epitopes by the primary antibody. Occasionally, “antigen retrieval” procedures will improve results but usually frozen sections are a better bet. An alternative approach, suitable for thin or porous tissues, is to perform immunohistochemistry on fresh tissues and then post-fix and embed the tissues in paraffin.

Decalcification of bone (optional):

After fixation, bone,must be decalcified, or else it won’t cut on the microtome:

Immerse tissue cassette in 11% formic acid with a stir bar overnight in a fume hood.

Rinse in running water for 30- 60 minutes (the smell should be gone).

Storage in 70% Ethanol:
After adequate fixation tissues are transferred to 70% ethanol and may be stored at 4°C.

Paraffin infiltration

In this procedure, tissue is dehydrated through a series of graded ethanol baths to displace the water, and then infiltrated with wax. The infiltrated tissues are then embedded into wax blocks. Once the tissue is embedded, it is stable for many years.

The most commonly used waxes for infiltration are the commercial paraffin waxes. A paraffin max is usually a mixture of straight chain or n-alkanes with a carbon chain length of between 20 and 40; the wax is a solid at room temperature but melts at temperatures up to about 65°C or 70°C. Paraffin wax can be purchased with melting points at different temperatures, the most common for histological use being about 56°C–58°C, At its melting point it tends to be slightly viscous, but this decreases as the temperature is increased. The traditional advice with paraffin wax is to use this about 2°C above its melting point. To decrease viscosity and improve infiltration of the tissue, technologists often increase the temperature to above 60°C or 65°C in practice to decrease viscosity.

In the schedule below, it is presumed that the working day is from 8:00 a.m. to 5:00 p.m. If other than that, appropriate adjustments should be made.

Tissue preparation

Thickness

No more than 3 mm thick.

Area

20 mm × 30 mm.

Fixed tissue

Cut large organs into 3 mm slices and store in neutral buffered formalin for 48 hours. Select tissue from fixed areas, trim to size and refix until the evening. If the trimmed sample is visibly unfixed, refix for a further 24 hours.

Unfixed tissue

Slices of tissue should be thoroughly fixed before processing.

Times

All times in processing fluids for this schedule are for tissues 3 mm thick or less. Tissues thicker than that will require longer times.

Clearing agent

Xylene or another clearing agent that will clear tissues in similar times should be used.

Processing time

This schedule takes 12 hours, and processes overnight. On weekends tissues should be left in fixative until Sunday evening with a 48 hour delay.

Trim fixed tissues and keep in neutral buffered formalin (NBF) until ready to proceed. Put tissues in a labeled (usually with pencil, as solvents dissolve the ink) cassette.

Once fixed, tissue is processed as follows, using gentle agitation, usually on a tissue processor, as follows:

1. 70% ethanol for 1 hour.

2. 95% ethanol (95% ethanol/5% methanol) for 1 hour.

3. First absolute ethanol for 1 hour .

4. Second absolute ethanol 1½ hours .

5. Third absolute ethanol 1½ hours.

6. Fourth absolute ethanol 2 hour.

7. First clearing agent ( Xylene or substitute) 1 hour.

8. Second First clearing agent (Xylene or substitute) 1 hour.

9. First wax (Paraplast X-tra) at 58°C for 1 hour.

10. Second wax (Paraplast X-tra) at 58°C 1 hour.

Due to the viscosity of molten paraffin wax, some form of gentle agitation is highly desirable. If the processor is to be run overnight it should be programmed to hold on the first ethanol bath and not finish until the next morning so the specimens do not sit in hot paraffin longer than the time indicated. If specimens are fresh they may incubate in formalin in the first stage on the machine. It is important to not keep the tissues in hot paraffin too long or else they become hard and brittle. Processed tissues can be stored in the cassettes at room temperature indefinitely.

Embedding tissues in paraffin blocks

Tissues processed into paraffin will have wax in the cassettes; in order to create smooth wax blocks, the wax first needs to be melted away placing the entire cassette in 58°C paraffin bath for 15 minutes. Turn the heat block on to melt the paraffin one hour before adding the tissue cassettes.

1. Open cassette to view tissue sample and choose a mold that best corresponds to the size of the tissue. A margin of at least 2 mm of paraffin surrounding all sides of the tissue gives best cutting support. Discard cassette lid.

2. Put small amount of molten paraffin in mold, dispensing from paraffin reservoir.

3. Using warm forceps, transfer tissue into mold, placing cut side down, as it was placed in the cassette.

4. Transfer mold to cold plate, and gently press tissue flat. Paraffin will solidify in a thin layer which holds the tissue in position.

5. When the tissue is in the desired orientation add the labeled tissue cassette on top of the mold as a backing. Press firmly.

6. Hot paraffin is added to the mold from the paraffin dispenser. Be sure there is enough paraffin to cover the face of the plastic cassette.

7. If necessary, fill cassette with paraffin while cooling, keeping the mold full until solid.

8. Paraffin should solidify in 30 minutes. When the wax is completely cooled and hardened (30 minutes) the paraffin block can be easily popped out of the mold; the wax blocks should not stick. If the wax cracks or the tissues are not aligned well, simply melt them again and start over.

The tissue and paraffin attached to the cassette has formed a block, which is ready for sectioning.Tissue blocks can be stored at room temperature for years.

Sectioning tissues

Tissues are sectioned using a microtome. Turn on the water bath and check that the temp is 35-37ºC. Use fresh deionized water (DEPC treated water must be used if in situ hybridization will be performed on the sections). Blocks to be sectioned are placed face down on an ice block or heat sink for 10 minutes. Place a fresh blade on the microtome; blades may be used to section up to 10 blocks, but replace if sectioning becomes problematic. Insert the block into the microtome chuck so the wax block faces the blade and is aligned in the vertical plane.

Set the dial to cut 10 µM sections to order to plane the block; once it is cutting smoothly, set to 5 µM
sections . The blade should angled at 5º. Face the block by cutting it down to the desired tissue plane and discard the paraffin ribbon. If the block is ribboning well then cut another four sections and pick them up with forceps or a fine paint brush and float them on the surface of the 37ºC water bath. Float the sections onto the surface of clean glass slides. If the block is not ribboning well then place it back on the ice block to cool off firm up the wax. If the specimens fragment when placed on the water bath then it may be too hot.

Place the slides with paraffin sections on the warming block in a 65°C oven for 20 minutes (so the wax just starts to melt) to bond the tissue to the glass. Slides can be stored overnight at room temperature.

Haematoxylin Eosin (H&E) staining

Lung tissue stained with the H&E technique. Nuclei are darkly stained in this image.

H&E stain, HE stain or hematoxylin and eosin stain, is a popular staining method in histology. It is the most widely used stain in medical diagnosis; for example when a pathologist looks at a biopsy of a suspected cancer, the histological section is likely to be stained with H&E and termed H&E section,H+E section, or HE section.

The staining method involves application ofhemalum, which is a complex formed from aluminium ions and oxidized hematoxylin. This colors nuclei of cells (and a few other objects, such as keratohyalin granules) blue. Materials colored blue by hemalum are often said to be basophilic, but this is an incorrect use of the word. The nuclear staining is folowed by counterstaining with an aqueous or alcoholic solution of eosin Y, which colors eosinophilic other structures in various shades of red, pink and orange.

Solutions:

Haematoxylin Solutions

Haematoxylin stains are commonly employed for histologic studies, often employed to color the nuclei of cells (and a few other objects, such as keratohyalin granules) blue. The mordants used to demonstrate nuclear and cytoplasmic structures are alum and iron, forming lakes or colored complexes (dye-mordant-tissue complexes), the color of which will depend on the salt used. Aluminium salt lakes are usually colored blue white while ferric salt lakes are colored blue-black.

The three main alum haematoxylin solutions employed are Ehrlich’s haematoxylin, Harris’s haematoxylin and Mayer’s haematoxylin. The name haemalum is preferable to “haematoxylin” for these solutions because haematein, a product of oxidation of haematoxylin, is the compound that combines with aluminium ions to form the active dye-metal complex. Alum haematoxylin solutions impart to the nuclei of cells a light transparent red stain which rapidly turns blue on exposure to any neutral or alkaline liquid.

Alum or potassium aluminium sulfate used as the mordant usually dissociates in an alkaline solution, combining with OH? of water to form insoluble aluminium hydroxide. In the presence of excess acid, aluminium hydroxide cannot be formed thus failure of aluminium haematoxylin dye-lake to form, due to lack of OH? ions. Hence, acid solutions of alum haematoxylin become red. During staining alum haematoxylin stained sections are usually passed on to a neutral or alkaline solution (e.g. hard tap water or 1% ammonium hydroxide) in order to neutralize the acid and form an insoluble blue aluminium haematin complex. This procedure is known as blueing.

When tap water is not sufficiently alkaline, or is even acid and is unsatisfactory for blueing haematoxylin, a tap water substitute consisting of 3.5 g NaHCO3 and 20 g MgSO4.7H2O in one liter of water with thymol (to inhibit formation of moulds), is used to accelerate blueing of thin paraffin sections. Addition of a trace of any alkali to tap or distilled water also provides an effective blueing solution; a few drops of strong ammonium hydroxide or of saturated aqueous lithium carbonate, added immediately before use, are sufficient for a 400 ml staining dish full of water. Use of very cold water slows down the blueing process, whereas warming accelerates it. In fact, the use of water below 10°C for blueing sections may even produce pink artifact discolorations in the tissue.

The staining of nuclei by hemalum does not require the presence of DNA and is probably due to binding of the dye-metal complex to arginine-rich basic nucleoproteins such as histones. The mechanism is different from that of nuclear staining by basic (cationic) dyes such as thionine or toluidine blue. Staining by basic dyes is prevented by chemical or enzymatic extraction of nucleic acids. Such extractions do not prevent staining of nuclei by hemalum.

Eosin Solutions

Eosin is a fluorescent red dye resulting from the action of bromine on fluorescein. It can be used to stain cytoplasm, collagen and muscle fibers for examination under the microscope. Structures that stain readily with eosin are termed eosinophilic.Eosin is most often used as a counterstain to haematoxylin in H&E (haematoxylin and eosin) staining. Eosin stains red blood cells intensely red. Eosin is an acidic dye and shows up in the basic parts of the cell, ie the cytoplasm. For staining, eosin Y is typically used in concentrations of 1 to 5 percent weight by volume, dissolved in water or ethanol. For prevention of mold growth in aqueous solutions, thymol is sometimes added. A small concentration (0.5 percent) of acetic acid usually gives a deeper red stain to the tissue.

Other colors, e.g. yellow and brown, can be present in the sample; they are caused by intrinsic pigments, e.g. melanin.

Some structures do not stain well. Basal laminae need to be stained by PAS stain or some silver stains in order to exhibit appropriate contrast. Reticular fibers also require silver stain. Hydrophobic structures also tend to remain clear; these are usually rich in fats, eg. adipocytes, myelin around neuron axons, and Golgi apparatus membranes.

Phosphate Assay – Lipids

Protocol

Introduction: This can be used for determining the phospholipids content. Be careful when

adding acid to the tubes. Most work should be done in the hood. It is best to practice using old

samples and a standard curve before using important experimental samples.

Protocol: Clin Chem Acta 121, 111-116. 1982

1 - Prepare a standard curve phosphate curve in triplicate.

(0, 25, 50, 75, 100, 150, 200, 400 μl of 1 mM KH2PO4) – calculate how many μg of phosphate are in each

tube you will need this later.

2 - Add 25, μl of sample in separate tubes. Do in triplicate.

3 - Dry standards in heating block inside hood

- dry organic solvent (lipid samples) under nitrogen.

4 - Add 100 μl concentrated H2SO4 to all tubes.

5 - Vortex and put tubes in the heating block for 10 min.

6 - Allow tubes to cool to room temperature and add 50 μl of 6% hydrogen peroxide

7 - Vortex tubes and place in heating block for 40 minutes.

8 - Allow tubes to cool and add 2 ml of H2O, mix well.

9 - Add 800 μl of Color reagent to each tube.

10 - Boil samples on hot plate or heat block for 10 - 15 minutes or until highest standard turns a very dark blue.

11 - Transfer to 1 ml cuvettes and read absorbance at 797 nm

12 - Plot standards as absorbance vs. μg phosphate

Solutions

50 1 mM KH2PO4

Color reagent

1:1 ammonium anhydride molybdic acid (0.625g/50ml): ascorbic acid (0.45 g / 50 ml)

Mix just prior to use.

6% H2O2 - (1 ml of 30% H2O2 and 4 ml of H2O) Make just prior to use

http://www.mnstate.edu/provost/PhosphateAssayprotocol.pdf

Wallert and Provost Lab

Protein targeting (2)

Sorting of proteins to both chloroplasts and mitochondria

Many proteins are needed in both mitochondria and chloroplasts. In general the targeting peptide is of intermediate character to the two specific ones. The targeting peptides of these proteins have a high content of basic and hydrophobic amino acids, a low content of negatively charged amino acids. They have a lower content of alanine and a higher content of leucine and phenylalanine. The dual targeted proteins have a more hydrophobic targeting peptide than both mitochondrial and chloroplastic ones.

Sorting of proteins to peroxisomes

All peroxisomal proteins are encoded by nuclear genes.

To date there are two types of known Peroxisome Targeting Signals (PTS):

Peroxisome targeting signal 1 (PTS1): a C-terminal tripeptide with a consensus sequence (S/A/C)-(K/R/H)-(L/A). The most common PTS1 is serine-lysine-leucine (SKL). Most peroxisomal matrix proteins possess a PTS1 type signal.

Peroxisome targeting signal 2 (PTS2): a nonapeptide located near the N-terminus with a consensus sequence (R/K)-(L/V/I)-XXXXX-(H/Q)-(L/A/F) (where X can be any amino acid).

There are also proteins that possess neither of these signals. Their transport may be based on a so-called "piggy-back" mechanism: such proteins associate with PTS1-possessing matrix proteins and are translocated into the peroxisomal matrix together with them.

Diseases

Peroxisomal protein tran

sport is defective in the following genetic diseases: Zellweger syndrome. Adrenoleukodystrophy (AL

D).

Refsum disease

Receptor-mediated endocytosis

Several molecules that attach to special receptors called clathrin coated pits on the outside of cells cause the cell to perform endocytosis, an invagination of the plasma membrane to incorporate the molecule and associated structures into endosomes. This mechanism is used for three main purposes:

Uptake of essential

metabolites, for example, LDL. Uptake of some hormones and growth factors, for example, epidermal growth factor and nerve growth factor. Uptake of proteins that are to be destroyed, for example, antigens in phagocytotic cells like macrophages.

Receptor-mediated endocytosis can also be "abused":

Some

viruses, for example, the Semliki forest virus, enter the cell through this mechanism. Cholera, diphtheria, anthrax, tetanus, botulinum, and

other bacterial toxins enter the cell this way.

Protein destruction

Defective proteins are occasionally produced, or they may be damaged later, for example, by oxidative stress. Damaged proteins can be recycled. Proteins can have very different half lifes, mainly depending on their N-terminal amino acid residue. The recycling mechanism is mediated by ubiquitin.

Protein targeting in bacteria

With some exceptions, Bacteria lack membrane-bound organelles as found in eukaryotes, but they may assemble proteins onto various types of inclusions such as gas vesicles and storage granules. Bacteria may have a single plasma membrane (Gram-positive bacteria), or an inner membrane plus an outer membrane separated by the periplasm (Gram-negative bacteria). Proteins may be incorporated into the plasma membrane, or either trapped in the periplasm or secreted into the environment, according to whether or not there is an outer membrane. The basic mechanism at the plasma membrane is similar to the eukaryotic one. In addition, bacteria may target proteins into or across the outer membrane. Systems for secreting proteins across the bacterial outer membrane may be quite complex and play key roles in pathogenesis. These systems may be described as type I secretion, type II secretion, etc.

In most Gram-positive bacteria, certain proteins are targeted for export across the plasma membrane and subsequent covalent attachment to the bacterial cell wall. A specialized enzyme, sortase, cleaves the target protein at a characteristic recognition site near the protein C-terminus, such as an LPXTG motif (where X can be any amino acid), then transfers the protein onto the cell wall. An system analogous to sortase/LPXTG, termed exosortase/PEP-CTERM, is proposed to exist in a broad range of Gram-negative bacteria.

Secretory pathways

The secretory pathway includes vesicular traffic, secretion, and endocytosis. Secretory proteins follow this pathway.

Early stages

Retrograde transport is common in the early stages. Proteins that have been successfully delivered to the Golgi apparatus advance through cisternal progression.

Later stages

Coated vesicles mediate several transport steps.


References

1. Kanner EM, Friedlander M, Simon SM. (2003). "Co-translational targeting and translocation of the amino terminus of opsin across the endoplasmic membrane requires GTP but not ATP". J. Biol. Chem. 278 (10): 7920–7926.

doi:10.1074/jbc.M207462200. PMID 12486130. 2. Kanner EM, Klein IK. et al. (2002). "The amino terminus of opsin translocates "posttranslationally" as efficiently as cotranslationally". Biochemistry 41 (24): 7707–7715. doi:10.1021/bi0256882. PMID 12056902.

(From Wikipedia, the free encyclopedia)

Biotech News

Powered by Feedzilla